The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

[RHD Gene Analysis of A Blood Donor with Del Phenotype].

OBJECTIVE: To analyze the RHD genotype of a blood donor with Del phenotype in Yunnan. METHODS: Rh serological phenotype was identified. RHD gene was detected by PCR-SSP typing, and its 10 exons were sequenced. Exon 9 was amplified for sequencing and analysis. RHD zygosity was detected. RESULTS: The Rh phenotype of this specimen was CcDelee. Genomic DNA exhibited a 1 003 bp deletion spanning from intron 8, across exon 9 into intron 9. The deletion breakpoints occurred between two 7-bp short tandem repeat sequences. There was no variation in the sequences of the remaining exons. The Rh hybridization box test showed that there was one RHD negative allele. CONCLUSION: This specimen is Del type caused by deletion of RHD exon 9.

Frequency and molecular basis of CD36 deficiency among platelet donors in Kunming, China.

CD36 is a multifunctional receptor expressed on the surface of many cell types. Among healthy individuals, CD36 may be absent on platelets and monocytes (type I deficiency) or platelets alone (type II deficiency). However, the exact molecular mechanisms underlying CD36 deficiency remain unclear. In this study, we aimed to identify individuals with CD36 deficiency and investigate the molecular basis underlying it. Blood samples were collected from platelet donors at Kunming Blood Center. Platelets and monocytes were isolated and CD36-expression levels were analyzed using flow cytometry. DNA from whole blood and mRNA isolated from monocytes and platelets of individuals with CD36 deficiency were analyzed using polymerase chain reaction (PCR) testing. The PCR products were cloned and sequenced. Among the 418 blood donors,7 (1.68%) were CD36 deficient: 1 (0.24%) with type I deficiency and 6(1.44%) with type II deficiency. Six heterozygous mutations occurred, including c.268C>T (in type I individuals), c.120 + 1 G>T, c.268C>T, c.329_330del/AC, c.1156 C>T, c.1163A>C, and c.1228_1239del/ATTGTGCCTATT (in type II individuals). Mutations were not detected in one type II individual . At the cDNA level, only mutant, but not wild-type, transcripts were detected in the platelets and monocytes of type I individual. In type II individuals, only mutant transcripts were found in platelets, whereas monocytes possessed wild-type and mutant transcripts. Interestingly, only alternative splicing transcripts were observed in the individual without mutation. We report the incidence rates of type I and II CD36 deficiencies among platelet donors in Kunming. Molecular genetic analyses of DNA and cDNA demonstrated that homozygous mutations on the cDNA level in platelets and monocytes or platelets alone identified type I and II deficiencies, respectively. Furthermore, alternatively spliced products also potentially contribute to the mechanism of CD36 deficiency.

What is the context? Healthy individuals may lack CD36 on platelets and (or) monocytes, which are defined as Type I and Type II CD36 deficiency. These individuals could develop anti-CD36 antibodies associated with immune-mediated disorders. However, the mechanism underlying the CD36 deficiency is still unclear. In this study, we reported the incidence of CD36 deficiency in Kunming platelet donors and found the new molecular basis of CD36 deficiency individuals.What's new? Molecular genetic analysis of cDNA derived from type I subjects showed the presence of mutant transcript only, both in platelets and monocytes. In type II subjects, platelets only carry mutant transcript, whereas monocytes possessed both wild-type and mutant transcripts. Furthermore, we found that alternatively spliced product of CD36 transcript could also contribute to the mechanism of CD36 deficiencies.What's the impact? Our finding indicates that analysis of CD36 at cDNA level is mandatory to verify different forms of CD36 deficiencies. This information may help us to understand the development of anti-CD36 antibodies in CD36 deficient individuals.

Characterization of Sphingomonas sp. JB13 exo-inulinase: a novel detergent-, salt-, and protease-tolerant exo-inulinase.

A glycoside hydrolase family 32 exo-inulinase gene was cloned from Sphingomonas sp. JB13 and expressed in Escherichia coli BL21 (DE3). The purified recombinant enzyme (rInuAJB13) showed an apparently optimal activity at pH 5.5 and 55 °C and remained activity at 10-70 °C. The addition of most metal ions and chemical reagents showed little or no effect (retaining more than 76.5 % activity) on the enzyme activity, notably the addition of surfactants SDS, CTAB, Tween 80, and Triton X-100. Most local liquid detergents, including Balin, Walch, Ariel, Tide, Tupperware, and Bluemoon, also showed little or no effect (retaining more than 77.8 % activity) on the enzyme activity. rInuAJB13 exhibited 135.3-163.6 % activity at the NaCl concentration of 1.0-4.5 M. After incubation with up to 57.0 mg mL(-1) trypsin and 90.0 mg mL(-1) proteinase K at 37 °C for 60 min (pH 7.2), rInuAJB13 retained more than 80 % of its initial activity. The enzyme presents a high proportion (28.0 %) of amino acid residues G, A, and V. This paper is the first to report a detergent-, salt-, and protease-tolerant exo-inulinase.

Cold-active and NaCl-tolerant exo-inulinase from a cold-adapted Arthrobacter sp. MN8 and its potential for use in the production of fructose at low temperatures.

An exo-inulinase gene was cloned from Arthrobacter sp. MN8, a cold-adapted bacterium isolated from lead-zinc-rich soil. The gene was expressed in Escherichia coli BL21(DE3). The resultant 505-residue polypeptide (InuAMN8) showed the highest identity (81.1%) with the putative levanase from Arthrobacter phenanthrenivorans Sphe3 (ADX73279) and shared 57.8% identity with the exo-inulinase from Bacillus sp. snu-7 (AAK00768). The purified recombinant InuAMN8 (rInuAMN8) showed an apparently optimal activity at 35°C, and 75.3%, 39.4%, and 15.8% of its maximum activity at 20°C, 10°C, and 0°C, respectively. After pre-incubation for 60 min at 50°C and 55°C, the rInuAMN8 exhibited 69.8% and 17.7% of its initial activity, respectively. The apparent Km values of rInuAMN8 towards inulin were 2.8, 1.5, 1.2, 5.3, and 8.2 mM at 0°C, 10°C, 20°C, 30°C, and 35°C, respectively. Inulin and Jerusalem artichoke tubers were effectively hydrolyzed to release fructose by rInuAMN8 at 0°C, 10°C, and 35°C. Compared with its hyperthermophilic and thermophilic counterparts, the exo-inulinase had less aromatic amino acid F and more hydrophobic amino acid A. In addition, the purified rInuAMN8 retained 127.9%-88.4% inulinase activity at 3.5%-15.0% (w/v) NaCl concentrations. Zn(2+) and Pb(2+) at 10 mM exhibited little or no effect on the enzyme activity. This paper is the first to report a cold-active and/or NaCl-tolerant exo-inulinase from the genus Arthrobacter. The exo-inulinase rInuAMN8 shows a potential for use in the production of fructose at low temperatures.

De novo sequencing and analysis of the termite mushroom (Termitomyces albuminosus) transcriptome to discover putative genes involved in bioactive component biosynthesis.

A one-eighth 454 sequencing run produced 82,386 high-quality reads. De novo assembly generated 6494 unique sequences. Based on the bioinformatic analysis, we found many the known enzymes involved in the biosynthesis of triterpene saponin in Termitomyces albuminosus, including 6 cytochrome P450 and 22 glycosyltransferase unique genes.